Research Article | Volume: 9, Issue: 1, Jan-Feb, 2021

Evolution of matK Gene among the Elite Tea Clones (Camellia sinensis) Revealed by Nucleotide Substitution within the Consensus Region

Reha Labar Pallab Kar Prosenjit Biswas Arnab Sen Malay Bhattacharya   

Open Access   

Published:  Jan 17, 2021

DOI: 10.7324/JABB.2021.9105
Abstract

The medicinally and economically important tea plant of India lacks a report on barcode study. Thus, we aimed to establish the DNA barcode of some elite tea clones of Darjeeling and Dooars along with the study of variation within the chloroplast region. A thorough investigation of 29 tea clones based on the matK (maturase K) gene has been carried out in our study. The laid objectives were fulfilled following DNA isolation, purification, amplification of the matK region, and sequencing. The sequences were further analyzed using BLAST analysis and phylogenetic tree construction along with the study of the aligned consensus region among all the clones. A BLAST search of NCBI revealed 24 clones to share 100% identity with Camellia sinensis. The remaining 5 clones showed 99.29–99.89% identity with Camellia sinensis. However, clones such as 11125 and 11126 showed a higher percentage of similarity, that is, 99.87% and 99.57% with other species of Camellia when compared, respectively, to 99.61% and 99.29% with Camellia sinensis. The relatedness to other Camellia species was also evident from the distinct cluster in the phylogenetic tree. This study reports a total of 14 variable sites within the matK region where the high consensus region revealed a total of nine variable sites and the low consensus region revealed a total of five variable sites. Therefore, this study is the first report of barcode analysis of Indian tea clones, wherein we successfully utilized the single locus matK gene to study variation within the chloroplast region and also conclude that the matK region is not 100% conserved with the same species of Camellia.


Keyword:     Camellia sinensis matK Blast Phylogenetic Consensus.


Citation:

Labar R, Kar P, Biswas P, Sen A, Bhattacharya M. Evolution of matK Gene among the Elite Tea Clones (Camellia sinensis) Revealed by Nucleotide Substitution within the Consensus Region. J App Biol Biotech. 2021;9(1):32-40. DOI: 10.7324/JABB.2021.9105

Copyright: Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike license.

HTML Full Text

1. INTRODUCTION

The medicinally important health beverage consumed worldwide as tea, belongs to the genus Camellia under the Theaceae family. The world-famous tea originated in China with five reported subspecies and two varieties among which Camellia sinensis L.O Kuntze is mostly cultivated worldwide to make the famous tea [1]. The predominant tea varieties cultivated worldwide are the China variety with small leaves (Camellia sinensis L.), large leaf Assam variety (Camellia sinensis var. assamica), and intermediate leaf Cambod varieties (Camellia assamica var. lasiocalyx) [2].

Apart from its medicinal importance, tea is one of the most important cash crops of India. The world-famous Darjeeling tea serves its purpose for the Indian economy due to its unique flavor and aroma. Darjeeling tea gardens have established several elite tea clones. Environmental influences and plant age make it harder to study genetic diversity based on morphological traits unlike the molecular traits [1].

A previous study on Darjeeling tea clones reports the study of genetic diversity using a robust technique such as the RAPD, ISSR, and AFLP markers [3-5]. However, no study has been reported in the genetic diversity of Darjeeling tea clones using matK primers.

DNA barcoding, a concise method for taxonomic identification, uses a standard short sequence with ample variation to differentiate among species. Many regions from the plastid genome such as the rbcL, rpoC1, rpoB, and trnH-psbA intergenic spacer apart from the matK region have been suggested and exploited for DNA barcoding of land plants [6,7]. However, the Consortium for the Barcode of Life (CboL) has recommended rbcL and matK as standard DNA barcode for plants because of its increased variation between species and the important role it plays in the phylogenetic restoration of terrestrial plants [8,9]. The matK gene around 1500 base pairs (bp) also known as orfK is utilized in the study of molecular systematics and evolution since the matK gene contains high substitution rates within species [10]. The matK gene, coding maturase protein, is responsible for splicing of Group II intron. It is located within the intron of the trnK gene whose two flanking exons were lost, thus leaving the gene intact for splicing [11]. Due to its high degree of substitution and variation than other genes, the matK gene is considered to evolve quickly [12]. The matK gene has ideal size and also a mutational conserved region along with a greater rate of substitution and low transition/transversion ratio. The sequence varies at the nucleic acid level at first and second codon positions. All of these features of matK have a profound impact on relationship study at family and species level [11].

Based on previous reports, we found that the Indian tea clones have no report on barcode analysis. Thus, the main objective of the work is to study the genetic diversity and variation within the chloroplast region of the tea clones grown in Darjeeling and Dooars. We collected 33 elite tea clones from the Darjeeling region, which is famous worldwide for tea. We have chosen matK, one of the standard DNA barcodes recommended for plants and also because of the fact of the matK gene having high substitution rates within species, which makes it ideal for our study. Therefore, we aim to perform barcode analysis of collected tea clones by fulfilling steps such as genomic DNA isolation, DNA purification, and quantification, PCR amplification of the matK region, sequencing of the amplified fragments, and sequence analysis using different tools of bioinformatics. This work highlights the importance of the utilization of a single-locus matK region to study intraspecific variation and also infers the evolution of the matK gene within the same species of Camellia.


2. MATERIALS AND METHODS

2.1. Sample Selection and Collection

A total of 33 tea clones were collected for this study [Table 1]. The samples were collected from Darjeeling hills.

Table 1: List of tea clones chosen for study.

SI. NoCloneAbbreviation/Alternative name
1Ambari Vallai 2AV2
2Phoobsering 312P312
3Happy valley 39HV39
4Tukdah 253T-253
5Nanda DeviTS 378
6Makaibari-6MB-6
7Teesta Valley 1TTV-1
8Tukdah 383T-383
9Kopati 1/1K1/1
10B-15/263Badamtam -15/263
11Balasun 7/1A/76BS 7/1A/76
12Bunnockburn 777B-777
13SundaramB/5/63
14Tukdah-135T-135
15Tocklai seed 378TS 378 or Nanda Devi
16Bunnockburn 688B-688
17GolcondaB/6/36
18Rungli Rungiliot 17/144RR-17/144
19Balasun 9/3/76BS-9/3/76
20Chiradew Parbat1CP-1
21Phoobsering 1404P-1404
22Phoobsering 1258P-1258
23Rungli Rungiliot 4/5RR-4/5
24Sikkim 1SKM-1
25Thurbo 3Thurbo-3
26Thurbo 9Thurbo-9
27Tukdah 145T-145
28Tukdah 246T-246
29Tocklai variety 19TV-19
30Tocklai variety 14TV-14
31Tukdah 78T-78
32Bannockburn 157B-157
33B/5/63Sundaram

2.2. DNA Barcoding

2.2.1. DNA Isolation

DNA was isolated from a 5 g fresh leaf sample of tea clones (Camellia sinensis) using the CTAB extraction method with slight modification [13]. For the CTAB DNA extraction method, 5 g of fresh and tender leaves of Camellia was taken and pulverized using a mortar and pestle using liquid nitrogen. The pulverized material was quickly transferred and mixed into an Oakridge tube containing pre-warmed CTAB extraction buffer. It was then incubated for 1 h at 65°C with occasional mixing in-between. An equal volume of chloroform and isoamyl alcohol (24:1) was added and gently mixed. It was then centrifuged at 6000 rpm for 10 min at room temperature. An equal volume of ice-cold isopropanol was added to the supernatant and mixed by inversion. Following incubation for 2 h at −20°C, the mixture was centrifuged at 6500 rpm for 30 min at 4°C. The supernatant was discarded and the pellet was washed thoroughly with 70% ice-cold ethyl alcohol and allowed to dry for about an hour. The pellet was dissolved in 500 ml of 1X TE buffer and to it, and an equal volume of equilibrated phenol was added and mixed properly followed by centrifugation at 13,000 rpm for 20 min. The upper aqueous layer was transferred into a fresh tube followed by the addition of an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuged at 10,000 rpm for 15 min at room temperature. The supernatant was again transferred to a new tube and treated with 1/10th volume of 3 M sodium acetate and double volume of ice-cold absolute ethyl alcohol. It was mixed gently and then centrifuged at 13,000 rpm for 30 min at 4°C. The supernatant was discarded and the pellet was washed using 70% ethanol, air-dried, and finally dissolved in 500 ml of 1X TE buffer.

2.2.2. DNA purification

RNA, protein, and polysaccharides being the main contaminants in crude DNA, hamper the isolation process and it is, therefore, very important to remove such impurities. CTAB was used to eliminate polysaccharides from DNA along with subsequent use of phenol:chloroform and RNase to further eliminate proteins and RNA to a large extent from crude DNA.

For the purification process, freshly prepared RNaseA was added into the buffered solution of DNA and incubated at 37°C for 1 h in a dry bath. An equal volume of chloroform:isoamyl alcohol (24:1) was added and mixed properly and centrifuged at 10,000 rpm for 15 min at room temperature. The supernatant was transferred to another tube and 1/10th volume of 3 M sodium acetate and double volume of ice-cold absolute ethyl alcohol was added followed by centrifugation at 13,000 rpm for 30 min at 4°C. Finally, the DNA pellet was washed using ice-cold 70% ethyl alcohol and air-dried and finally dissolved in 100 ml of 1X TE buffer.

2.2.3. DNA quantification

The isolated DNA was quantified using a UV spectrophotometer (Agilent Technologies Cary 60 UV–Vis) at 260 and 280 nm filters. The samples providing the ratio of absorbance at 260 nm to absorbance at 280 nm equivalent to 1.8 was only considered of good quality.

2.2.4. PCR amplification and sequencing of the matK region

The matK region was amplified in a 25 μl reaction volume comprising of 12.5 μl of GoTaq PCR master mix, 1.25 μl of matK-F and matK-R, 2 μl of DNA, and 8 μl of pyrogen-free water. The working concentrations taken for primers were 1.236 μM (matK-F) and 0.958 μM (matK-R), respectively. The details of the primers are given in Table 2. The PCR reactions were performed on a thermocycler (Applied Biosystems Veritti 96-well Thermal Cycle) using the following conditions: Denaturation of template DNA at 94°C for 4 min followed by 35 cycles of reactions: 94°C for 1 min, primer annealing at 48°C for 30 s, and primer extension at 72°C for 1 min with the final extension cycle at 72°C for 7 min. The success of the PCR was verified by agarose gel electrophoresis. The PCR product (5 ml) was run in an agarose gel (1%) and visualized under UV transilluminator. DNA sequencing was done using (ABI 3730 XL) from Bioserve Biotechnologies Pvt. Ltd.

Table 2: Details of matK primer.

Primer usedTm of primerAnnealing temperatureConc. of primer (pm/μl)Length of primer with sequence
matK forward (F)4648°C161.8322 (CGATCTATTCATTCAATATTTC)
matK reverse (R)5348°C208.3822(TCTAGCACACGAAAGTCGAAGT)

2.2.5. Sequence submission

The obtained sequences were edited as per the NCBI guidelines (www.ncbi.nlm.nih.gov) and further compared by querying against existing global sequences in the GenBank database (https://blast.ncbi.nlm.nih.gov/Blast.cgi) using Nucleotide BLAST algorithm. Blastn and blastx were performed consecutively. The sequences were then further submitted in NCBI using the BankIt submission gateway (https://www.ncbi.nlm.nih.gov/WebSub/). The accessions number provided was retrieved from the database [Table 3].

Table 3: Accession number and details of the submitted matK sequence retrieved from NCBI.

Full nameAbbreviationNCBI accessionUnique IdBase pairs
Ambari Vallai 2AV2MH6492841111757 bp
Phoobsering 312P312MK3933941112871 bp
Happy valley 39HV39MH7914171113864 bp
Tukdah 253T-253MH9203151114876 bp
Nanda DeviTS 378MH9203161115816 bp
Makaibari-6MB-6MH9203171116758 bp
Teesta Valley 1TTV-1MH9203181117861 bp
Kopati 1/1K1/1MH9203191119774 bp
Balasun 7/1A/76BS 7/1A/76MK39339311111833 bp
Bunnockburn 777B-777MK39339511112757 bp
SundaramB/5/63MK39339611113644 bp
Tukdah-135T-135MK39339711114763 bp
Bunnockburn 688B-688MK39339811116833 bp
GolcondaB/6/36MK39339911117644 bp
Rungli Rungiliot 17/144RR-17/144MK39340011118826 bp
Balasun 9/3/76BS-9/3/76MK39340111119756 bp
Chiradew Parbat1CP-1MK39340211120761 bp
Phoobsering 1404P-1404MK39340311121763 bp
Phoobsering 1258P-1258MK39340411122751 bp
Rungli Rungiliot 4/5RR-4/5MK39340511123746 bp
Sikkim 1SKM-1MK42486511124867 bp
Thurbo 3Thurbo-3MN48032111125761 bp
Thurbo 9Thurbo-9MN48032211126707 bp
Tukdah 145T-145MK42486611127761 bp
Tukdah 246T-246MK42486711128756 bp
Tocklai variety 19TV-19MK42486811129750 bp
Tocklai variety 14TV-14MK42486911130735 bp
Tukdah 78T-78MK42487011131755 bp
Bannockburn 157B-157MK42487111132735 bp

2.3. Sequence Analysis

Complete 29 experimental sequences of Camellia sinensis clones were taken for final sequence analysis. A total of four sequences were excluded from the final dataset based on its short size (<600 base pairs) or sequencing error. The barcode sequences of the matK region of tea clones were further analyzed using MEGA X (Molecular Evolutionary Genetics Analysis) software (https://www.megasoftware.net/).

The DNA sequences were first aligned (pairwise alignment and multiple sequence alignment) using ClustalW and an evolutionary history was inferred using clustering methods such as neighbor-joining [14] and Unweighted Pair Group Mean Average method [15] with arithmetic mean (UPGMA) of MEGA X [16]. The bootstrap value was set to 1000 replicates. The phylogenetic tree drawn to scale was inferred with branch lengths in the same units as evolutionary distances. The evolutionary distances were computed using the Kimura 2- parameter method [17] with the units given as the number of base substitutions per site. The first, second, and third codon positions were included. Small sequences were not considered for analysis as well as all positions containing gaps and missing data were eliminated from the dataset. There were a total of 563 positions in the final dataset.

Further genetic pairwise distance for matK was calculated using the Kimura 2-parameter model [17] and maximum composite likelihood model [18] as given in MEGA X. Sequences were further aligned using Multalin V.5.4.1 (http://multalin.toulouse.inra.fr/ multalin/) and analysis of both high consensus and low consensus region was done. A different number of nucleotide frequencies and position of nucleotide along the consensus region were studied using Multalin (http://multalin.toulouse.inra.fr/multalin/) software V.5.4.1 [19]. Illustrative representation of the DNA barcode was done employing the sequences in matK QR code generator [20] and Biorad barcode generator (http://biorad-ads.com/DNABarcodeWeb/).


3. RESULTS

3.1. matK Amplification and Sequencing

The primer used for analysis showed successful amplification of matK [Figure 1] in all the studied clones. The size of the amplified PCR products was approximately within the range of 900 bp–1000 bp. However, the final sequencing result provided matK sequences of size ranging from 644 bp to 876 bp. The accession number for the submitted sequences and the details is provided in Table 3.

Figure 1: Amplification of the matK region. Lane L1: 100 bp ladder; lane 1–33: 33 tea clones.



[Click here to view]

3.2. Blast Result

Blast analysis revealed 24 clones out of 29 to be 100% identical with Camellia sinensis. The percentage of similarity with Camellia sinensis recorded for other clones was 99.29% (Thurbo 9), 99.61% (Thurbo 3), 99.64% (RR-4/5), 99.88% (SKM-1), and 99.89% (P312). Despite showing 99.61% (Thurbo 3) and 99.29% (Thurbo 9) similarity with Camellia sinensis, both the clones showed a higher percentage of similarity with other species of Camellia, that is, Thurbo 3 showed 99.87% and Thurbo 9 showed 99.57% similarity with Camellia mairei (KJ197933.1). Thus, a percentage similarity value below 99.64% placed the clones under different species of Camellia.

3.3. Sequence Alignment and Phylogenetic Tree Construction

Both neighbor-joining [Online Resource 1(SM1)] and UPGMA [Figure 2] tree revealed variation among the sequences. All the combined nucleotide sequences clustered together with exceptions such as Thurbo 3 (11125), Thurbo 9 (11126) clustering together, and P312 (1112) and RR-17/144 (11118) differing from the main group. To validate our results, we also constructed a phylogenetic tree adding a sequence of different Camellia species (KJ197933.1) taken from the NCBI database. Thurbo 3 (11125) and Thurbo 9 (11126) now clustered with the reference sequence of Camellia mairei (KJ197933.1) as depicted by the neighbor- joining [Figure 3] and UPGMA tree [Online Resource 2(SM1)]).

Figure 2: UPGMA tree method showing the genetic relationship of matK region between 29 tea clones.



[Click here to view]
Figure 3: Neighbor-joining tree method showing the genetic relationship of matK region between 29 tea clones along with sequence of Camellia mairei (KJ197933.1) taken from NCBI.



[Click here to view]

3.4. Sequence Analysis

The genetic distances for the matK sequence ranged from 0 to 0.0090 (Nucleotide: Maximum composite likelihood method) given in Figure 4 and from 0 to 0.0089 (Nucleotide: Kimura 2-parameter method) given as Online Resource 3 (SM1). The overall mean distance was recorded as 0.0013. The results show the number of base substitutions per site and are based on an analysis of a total of 29 sequences (all codon positions included) with a total of 563 positions in the final dataset excluding the eliminated positions containing gaps and missing data.

Figure 4: Genetic distances of the matK sequence calculated using nucleotide: maximum composite likelihood method.



[Click here to view]

The matK sequence showed two unique variable sites in Thurbo 3, Thurbo 9, and Camellia mairei that differed from the rest of the sequences. This was validated by a high consensus sequence of 563 bp prepared using Multalin software. A total of nine substitutions were observed in high consensus region where Thurbo 3 (11125) showed a total of three variable sites, Thurbo 9 (11126) showed a total of four variable sites and some single variable site was seen in P312 (1112) and RR-17/144 (11118), as shown in Figure 5 and Online Resource 4a (SM2). Study of low consensus region also revealed a total of five nucleotide substitution or variation with SKM-1 (11124) showing three variable sites, and Thurbo 9 (11126) and P1258 (11122) sowing one variable site each [Online Resource 4b (SM2)].

Figure 5: Consensus region of the aligned sequences showing nucleotide substitution as highlighted by black box.



[Click here to view]

The sequences are represented illustratively as barcode and QR code [Figure 6 and Online Resource 5 (SM3)]. The QR code generated can be decoded as DNA sequences that make data storage and retrieval comparatively easy.

Figure 6: matK sequences represented illustratively as barcode and QR code.



[Click here to view]

4. DISCUSSION

With the advancement of technology, sequencing analysis has uplifted the research in the molecular field, and thus, a small difference or rather variation (intraspecific or interspecific) can be studied which could not be accomplished easily using morphological means or other robust molecular techniques.

DNA barcoding is used for species identification and it utilizes many plastid and nuclear regions. A total of the seven-plastid region were explored in land plants and the combination of rbcL+matK was considered as the best combination for plant barcode [21]. Some other scientific studies reported the successful use of a combination of matK+ITS and rbcL+trnH-psbA to study 100% differences between Cassia species [22]. However, the efficiency of only a single matK region to differentiate Vachellia species from other Acacia species was reported earlier with concluding remarks about the possibility of utilizing matK for separating taxa at the genus level [23].

Some previous reports have suggested successful amplification and use of the matK region to investigate phylogeny in both monocots and dicots such as Zingiberaceae [11], Erythronium [24], Myristica fragrans [25], local tomato [26], and oil-bearing roses [27].

The barcode technique is also used nowadays to detect any kind of contaminants. Researchers have reported the presence of adulterant with counter indications for pregnant women in bamboo tea products and also detected the origin of bamboo leaves that were used in the product [28]. Researchers have also used DNA barcodes (rbcL, matK, ITS2, and psbA-trnH) to distinguish between the commercial non-Camellia tea and the adulterants present in it, to assess their safety, although a limited number of original plant sequences in GenBank limited the findings [29]. There are reports of matK locus placing two genera Myristica and Knena differently at a sequence similarity of 99.43% while genus Virola differed with 99.25% [25]. The tomatoes were placed within the same species even with 99.64% similarity, thus limiting the assumption of percentage identity required as 99.74–100% to place organisms within the same species [30]. Whereas our study has differentiated two species at percentage identity below 99.64% with clones such as 11125 (Thurbo 3) and 11126 (Thurbo 9) showing 99.61% and 99.29% identity with Camellia sinensis when compared, respectively, to 99.87% and 99.57% identity with Camellia mairei.

Two species T. cope and T. wightii [31] did not differ at rbcl locus but showed a difference in matK (2 nucleotide difference) and trnH-psbA (1 nucleotide difference). This could broaden the interspecific variation if the two loci are considered as two-gene approach and thus they reported interspecific variation (p-distance 0.002–0.003) but no intraspecific variation (p-distance 0.00). Another work reported having three variable sites in trnH-psbA sequences among seven tomato varieties with genetic distance ranging from 0 to 0.004 [26]. On the contrary, rbcL, rpoC1, and rpoB sequences did not show any variable sites, thus suggesting it to be 100% conserved within the species. The matK locus failed to differentiate Myristica at species level since the blast results showed 100% similarity with other three species of Myristica and also reported three nucleotide differences with Rivola sebifera and four nucleotide difference with Knema laurina, thus concluding the ability of matK locus to differentiate only at the genus level within the family of Myristicaceae. However, in our study, we report a total of nine variable sites in the high consensus region and a total of five variable sites in the low consensus region of matK sequences within the same species of Camellia sinensis. Therefore, we report intraspecific variation and conclude with a fact of matK sequence not being 100% conserved within the same species of Camellia.


5. CONCLUSION

This work reports the successful use of the matK region to explore the genetic diversity and variation within the matK gene of chloroplast region among the elite clones of Darjeeling and Dooars. The employment of the matK region with its known increased rate of substitution, low transition/transversion ratio, and quick evolving rate aided to study the intraspecific variation due to probable contamination from other tea plants. The evolution of the matK region within the same species of Camellia sinensis was evident from our results where we report variable sites within the consensus region and conclude with the fact of the matK gene not being 100% conserved among Camellia sinensis. The DNA barcode of elite tea clones of Darjeeling and Dooars was thus established, wherein we conclude with the remark of matK being a good candidate for DNA barcoding of Camellia sinensis as well as for rapid detection of variation and molecular evidence of clones at a minimal cost, thus avoiding other robust molecular techniques.


6. ACKNOWLEDGMENTS

Reha Labar is thankful to the University Grants Commission (UGC-RGNF-SC) for providing the fellowship. We also acknowledge the prompt service provided by the National Centre of Biotechnology Information and Bioserve Sequencing Services.


7. FUNDING

University Grants Commission (UGC-RGNF-SC).


8. AUTHOR CONTRIBUTIONS

All authors made substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; took part in drafting the article or revising it critically for important intellectual content; agreed to submit to the current journal; gave final approval of the version to be published; and agree to be accountable for all aspects of the work.


9. CONFLICTS OF INTEREST

The authors report no conflicts of interest in this work.


10. ETHICAL APPROVALS

This study does not involve the use of animals or human subjects.

REFERENCES

1. Lee SC, Wang CH, Yen CE, Chang C. DNA barcode and identification of the varieties and provenances of Taiwan's domestic and imported made teas using ribosomal internal transcribed spacer 2 sequences. J Food Drug Anal 2017;25:260-74. [CrossRef]

2. Sharma RK, Bhardwaj P, Negi R, Mohapatra T, Ahuja PS. Identification, characterization and utilization of unigene derived microsatellite markers in tea (Camellia sinensis L.). BMC Plant Biol 2009;9:53. [CrossRef]

3. Baruah AR, Hemanta S, Biswajit B. Detection of close genetic relatedness in some tea genotypes of Assam and Darjeeling using RAPD markers. J Plant Crops 2010;38:11-5.

4. Mishra RK, Sen-Mandi S. Genetic diversity estimates for Darjeeling tea clones based on amplified fragment length polymorphism markers. J Tea Sci 2004;24:86-92.

5. Roy SC, Chakraborty BN. Genetic diversity and relationships among tea (Camellia sinensis) cultivars as revealed by RAPD and ISSR based fingerprinting. Indian J Biotechnol 2009;8:370-6.

6. Kress WJ, Erickson DL. A two-locus global DNA barcode for land plants:The coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS One 2007;2:e508. [CrossRef]

7. Singh HK, Parveen I, Raghuvanshi S, Babbar SB. The loci recommended as universal barcodes for plants on the basis of floristic studies may not work with congeneric species as exemplified by DNA barcoding of Dendrobium species. BMC Res Notes 2012;5:42. [CrossRef]

8. Bafeel SO, Arif IA, Bakir MA, Khan HA, Al Farhan AH, Al Homaidan AA, et al. Comparative evaluation of PCR success with universal primers of maturase K (matK) and ribulose-1, 5-bisphosphate carboxylase oxygenase large subunit (rbcL) for barcoding of some arid plants. Plant Omics 2011;4:195.

9. Kuzmina ML, Johnson KL, Barron HR, Hebert PD. Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library. BMC Ecol 2012;12:1-11. [CrossRef]

10. Hilu KW, Liang G. The matK gene:Sequence variation and application in plant systematics. Am J Bot 1997;84:830-9. [CrossRef]

11. Selvaraj D, Sarma RK, Sathishkumar R. Phylogenetic analysis of chloroplast matK gene from Zingiberaceae for plant DNA barcoding. Bioinformation 2008;3:24. [CrossRef]

12. Barthet MM. Expression and Function of the Chloroplast-encoded Gene matK, Doctoral Dissertation. Virginia:Virginia Polytechnic Institute and State University;2006.

13. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 1987;19:11–15

14. Saitou N, Nei M. The neighbor-joining method:A new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406-25.

15. Sneath PH. Numerical Taxonomy:The Principles and Practice of Numerical Classification. United States:W.H. Freeman &Co Ltd.;1973. 573.

16. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X:Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 2018;35:1547-9. [CrossRef]

17. Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980;16:111-20. [CrossRef]

18. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci 2004;101:11030-5. [CrossRef]

19. Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 1988;16:10881-90. [CrossRef]

20. More RP, Mane RC, Purohit HJ. MatK-QR classifier:Patterns based approach for plant species identification. BioData Mining 2016;9:39. [CrossRef]

21. Group CP, Hollingsworth PM, Forrest LL, Spouge JL, Hajibabaei M, Ratnasingham S, et al. A DNA barcode for land plants. Proc Natl Acad Sci 2009;106:12794-7. [CrossRef]

22. Purushothaman N, Newmaster SG, Ragupathy S, Stalin N, Suresh D, Arunraj DR, et al. A tiered barcode authentication tool to differentiate medicinal Cassia species in India. Genet Mol Res 2014;13:2959-68. [CrossRef]

23. Steven GN, Subramanyam R. Testing plant barcoding in a sister species complex of pantropical Acacia (Mimosoideae, Fabaceae). Mol Ecol Resour 2009;9:172-80. [CrossRef]

24. Allen GA, Soltis DE, Soltis PS. Phylogeny and biogeography of Erythronium (Liliaceae) inferred from chloroplast matK and nuclear rDNA ITS sequences. Syst Bot 2003;28:512-23.

25. Tallei TE, Kolondam BJ. DNA barcoding of Sangihe Nutmeg (Myristica fragrans) using matK gene. Hayati J Biosci 2015;22:41-7. [CrossRef]

26. Caprar M, Copaci CM, Chende DM, Sicora O, Sumalan R, Sicora C. Evaluation of genetic diversity by DNA barcoding of local tomato populations from North-Western Romania. Not Bot Horti Agrob Cluj Napoca 2017;45:276-9. [CrossRef]

27. Wang H, Yao L, Cai R, Pan J, Chen X. Genetic relationship analyses of oil-bearing roses in China using matK sequences. Sci Horticult 2012;137:121-4. [CrossRef]

28. Horn T, Haser A. Bamboo tea:Reduction of taxonomic complexity and application of DNA diagnostics based on rbcL and matK sequence data. PeerJ 2016;4:e2781. [CrossRef]

29. Long P, Cui Z, Wang Y, Zhang C, Zhang N, Li M, et al. Commercialized non-Camellia tea:Traditional function and molecular identification. Acta Pharm Sin B 2014;4:227-37. [CrossRef]

30. Lawodi EN. Variasi genetik tanaman tomat dari beberapa tempat di sulawesi utara berdasarkan gen matk. Pharmacon 2013;2:3098.

31. Ragupathy S, Newmaster SG, Murugesan M, Balasubramaniam V. DNA barcoding discriminates a new cryptic grass species revealed in an ethno botany study by the hill tribes of the Western Ghats in Southern India. Mol Ecol Resour 2009;9:164-71. [CrossRef]

Reference

1. Lee SC, Wang CH, Yen CE, Chang C. DNA barcode and identification of the varieties and provenances of Taiwan's domestic and imported made teas using ribosomal internal transcribed spacer 2 sequences. J Food Drug Anal 2017;25:260-74. https://doi.org/10.1016/j.jfda.2016.06.008

2. Sharma RK, Bhardwaj P, Negi R, Mohapatra T, Ahuja PS. Identification, characterization and utilization of unigene derived microsatellite markers in tea (Camellia sinensis L.). BMC Plant Biol 2009;9:53. https://doi.org/10.1186/1471-2229-9-53

3. Baruah AR, Hemanta S, Biswajit B. Detection of close genetic relatedness in some tea genotypes of Assam and Darjeeling using RAPD markers. J Plant Crops 2010;38:11-5.

4. Mishra RK, Sen-Mandi S. Genetic diversity estimates for Darjeeling tea clones based on amplified fragment length polymorphism markers. J Tea Sci 2004;24:86-92.

5. Roy SC, Chakraborty BN. Genetic diversity and relationships among tea (Camellia sinensis) cultivars as revealed by RAPD and ISSR based fingerprinting. Indian J Biotechnol 2009;8:370-6.

6. Kress WJ, Erickson DL. A two-locus global DNA barcode for land plants: The coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS One 2007;2:e508. https://doi.org/10.1371/journal.pone.0000508

7. Singh HK, Parveen I, Raghuvanshi S, Babbar SB. The loci recommended as universal barcodes for plants on the basis of floristic studies may not work with congeneric species as exemplified by DNA barcoding of Dendrobium species. BMC Res Notes 2012;5:42. https://doi.org/10.1186/1756-0500-5-42

8. Bafeel SO, Arif IA, Bakir MA, Khan HA, Al Farhan AH, Al Homaidan AA, et al. Comparative evaluation of PCR success with universal primers of maturase K (matK) and ribulose-1, 5-bisphosphate carboxylase oxygenase large subunit (rbcL) for barcoding of some arid plants. Plant Omics 2011;4:195.

9. Kuzmina ML, Johnson KL, Barron HR, Hebert PD. Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library. BMC Ecol 2012;12:1-11. https://doi.org/10.1186/1472-6785-12-25

10. Hilu KW, Liang G. The matK gene: Sequence variation and application in plant systematics. Am J Bot 1997;84:830-9. https://doi.org/10.2307/2445819

11. Selvaraj D, Sarma RK, Sathishkumar R. Phylogenetic analysis of chloroplast matK gene from Zingiberaceae for plant DNA barcoding. Bioinformation 2008;3:24. https://doi.org/10.6026/97320630003024

12. Barthet MM. Expression and Function of the Chloroplast-encoded Gene matK, Doctoral Dissertation. Virginia: Virginia Polytechnic Institute and State University; 2006.

13. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 1987;19:11-15

14. Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406-25.

15. Sneath PH. Numerical Taxonomy: The Principles and Practice of Numerical Classification. United States: W.H. Freeman & Co Ltd.; 1973. p. 573.

16. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 2018;35:1547-9. https://doi.org/10.1093/molbev/msy096

17. Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980;16:111-20. https://doi.org/10.1007/BF01731581

18. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci 2004;101:11030-5. https://doi.org/10.1073/pnas.0404206101

19. Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 1988;16:10881-90. https://doi.org/10.1093/nar/16.22.10881

20. More RP, Mane RC, Purohit HJ. MatK-QR classifier: Patterns based approach for plant species identification. BioData Mining 2016;9:39. https://doi.org/10.1186/s13040-016-0120-6

21. Group CP, Hollingsworth PM, Forrest LL, Spouge JL, Hajibabaei M, Ratnasingham S, et al. A DNA barcode for land plants. Proc Natl Acad Sci 2009;106:12794-7. https://doi.org/10.1073/pnas.0905845106

22. Purushothaman N, Newmaster SG, Ragupathy S, Stalin N, Suresh D, Arunraj DR, et al. A tiered barcode authentication tool to differentiate medicinal Cassia species in India. Genet Mol Res 2014;13:2959-68. https://doi.org/10.4238/2014.April.16.4

23. Steven GN, Subramanyam R. Testing plant barcoding in a sister species complex of pantropical Acacia (Mimosoideae, Fabaceae). Mol Ecol Resour 2009;9:172-80. https://doi.org/10.1111/j.1755-0998.2009.02642.x

24. Allen GA, Soltis DE, Soltis PS. Phylogeny and biogeography of Erythronium (Liliaceae) inferred from chloroplast matK and nuclear rDNA ITS sequences. Syst Bot 2003;28:512-23.

25. Tallei TE, Kolondam BJ. DNA barcoding of Sangihe Nutmeg (Myristica fragrans) using matK gene. Hayati J Biosci 2015;22:41-7. https://doi.org/10.4308/hjb.22.1.41

26. Caprar M, Copaci CM, Chende DM, Sicora O, Sumalan R, Sicora C. Evaluation of genetic diversity by DNA barcoding of local tomato populations from North-Western Romania. Not Bot Horti Agrob Cluj Napoca 2017;45:276-9. https://doi.org/10.15835/nbha45110601

27. Wang H, Yao L, Cai R, Pan J, Chen X. Genetic relationship analyses of oil-bearing roses in China using matK sequences. Sci Horticult 2012;137:121-4. https://doi.org/10.1016/j.scienta.2012.01.026

28. Horn T, Haser A. Bamboo tea: Reduction of taxonomic complexity and application of DNA diagnostics based on rbcL and matK sequence data. PeerJ 2016;4:e2781. https://doi.org/10.7717/peerj.2781

29. Long P, Cui Z, Wang Y, Zhang C, Zhang N, Li M, et al. Commercialized non-Camellia tea: Traditional function and molecular identification. Acta Pharm Sin B 2014;4:227-37. https://doi.org/10.1016/j.apsb.2014.02.006

30. Lawodi EN. 2. Variasi genetik tanaman tomat dari beberapa tempat di sulawesi utara berdasarkan gen matk. Pharmacon 2013;2:3098.

31. Ragupathy S, Newmaster SG, Murugesan M, Balasubramaniam V. DNA barcoding discriminates a new cryptic grass species revealed in an ethno botany study by the hill tribes of the Western Ghats in Southern India. Mol Ecol Resour 2009;9:164-71. https://doi.org/10.1111/j.1755-0998.2009.02641.x

Article Metrics
465 Views 171 Downloads 636 Total

Year

Month

Related Search

By author names

Similar Articles

DNA barcode of matK combined with ITS effectively distinguishes the medicinal plant Stephania brachyandra Diels collected in Laocai, Vietnam

Nhan Thi Thanh Pham, Dung Phuong Le, Khanh Thi Ngoc Pham,, Xaykham Thipphavong,, Mau Hoang Chu

Evaluating DNA barcoding using five loci (matK, ITS, trnH- psbA, rpoB, and rbcL) for species identification and phylogenetic analysis of Capsicum frutescens

Meetali Chinnkar, Pratima Jadhav

The matK gene analysis in five types of matoa (Pometia pinnata J. R. Forst. and; G. Forst) based on the pericarp colour

Farra Ummush Sholiha, Endang Yuniastuti,, Sri Hartati

DNA barcoding-based molecular profiling of Bougainvillea, Dianthus, and Plumeria using matK locus

Nischay Patel, Wesley Ochieng’ Otieno, Nilesh D. Gawande, Sourabh Parmar, Karthik H N, Subramanian Sankaranarayanan

Molecular identification and optimization of cultural conditions for mycelial biomass production of wild strain of Chlorophyllum molybdites (G.Mey) Massee from the Philippines

Benjie L. Garcia, Jerwin R. Undan, Rich Milton R. Dulay, Sofronio P. Kalaw, Renato G. Reyes

Application of the PCR and allele-specific PCR-nucleic acid lateral flow immunoassay for the detection of the SRY gene and the G1138A mutation in the FGFR3 gene for the human DNA

Anupong Sukjai, Theerapong Puangmali, Khunton Wichajarn, Monthira Monthatong

Enhancing resistance to blast disease through CRISPR/Cas9 gene editing technology in OsHDT701 gene in RPBio-226 rice cv. (Oryza sativa L.)

Shravya Mathsyaraja, Saida Lavudi, Prathap Reddy Vutukuri

Anticancer effect of bioactive compound Apparicine isolated from the Tabernaemontana divaricata on retinoblastoma cancer cell line (Y79) and in silico docking approaches

Elango Rajeswari, Balu Prakash, Durai Mahendran, Devarajan Natarajan

Phylogenetic Analysis of Voltage Gated Ion Channels

Ajit Kumar

Genome-wide identification and expression analysis along the leaf developmental gradient of the sigma factor gene family in foxtail millet (Setaria italica)

Hongyun Liu, Jinjin Cheng, Siyuan Cheng, Hui Fan , Bo Wen , Zheng Liu

Morphological, histopathological and molecular characterization of Thelohanellus muscularis n. sp. (Cnidaria: Myxosporea) infecting head muscles of Labeo rohita from Ranjit sagar wetland, Punjab (India)

Harpreet Kaur, Aditya Gupta

Biochemical and molecular characterization of a new pullulan producer Rhodosporidium paludigenum PUPY-06

RS Singh, Navpreet Kaur

Plasticity of tandem repeats in expressed sequence tags of angiospermic and non-angiospermic species: Insight into cladistic, phenetic, and elementary explorations

Shamshad Ul Haq, Prerna Dhingra, Meenakshi Sharma, S. L. Kothari, Sumita Kachhwaha

Molecular identification of endophytic fungi associated with Coleus forskohlii (Willd.) Briq.

Grace Leena Crasta,, Koteshwar Anandrao Raveesha,

The ITS2 DNA sequence analysis in six species of barbin fishes with phylogenetic insights

Sandip Choudhury, Briyanka Kashyap, Karabi Dutta

Assessing DNA barcodes species discriminating ability and phylogenetic relation within Embelia species

Shrisha Naik Bajpe,, K. M. Marulasiddaswamy, Ramith Ramu, Abhijeeth S. Badiger, Maruthi Katenahally Rudrappa, Ramachandra Kukkundoor Kini

Molecular characterization and antibacterial properties of endophytic fungi Lasidiplodia theobromae in Lobelia nicotianifolia Roth ex Schult. of central Western Ghats of Karnataka, India

Krishnappa Vinu, Maddappa Krishnappa, Venkatarangaiah Krishna

DNA barcoding for species identification and phylogenetic investigation employing five genetic markers of Withania coagulans

Neelam Balkrishna Bare, Pratima Sharad Jadhav, Manivel Ponnuchamy

Microbial diversity of river Ganga at Haridwar (Uttarakhand) through metagenomic approaches

Annapurna Katara, Sumit Chand, Harshvardhan Chaudhary, Harish Chandra, Ramesh Chand Dubey

Study of morphology and orchid mycorrhizal associations in Malaxis rheedei

B. S. Jyothsna, Radha Mahendran, Manish Raj Mishra, Sanjay Dey, Deepti Srivastava

Refined Evolutionary Trees Through an Exceptionally Compatible Alignment-Substitution Model

Ashish Runthala, K. Sowmya, Shamantha Nasika, Bhimavarapu Sai, Atanu Talukdar, Vijayakumar Rajendran, S. Karthikeyan, T. Silambarasan, Manmohan Sharma

DNA barcoding and phylogenetic analysis of Indian Phyllanthus using nrITS and chloroplast rbcL gene sequences for molecular identification

Raghavendra Polasam, Pushpalatha Ganesh, Gururaj Chalageri, R. Kannan, U. V. Babu

First record of Pluchea dioscoridis (Asteraceae) in AL-Chibayish, Southern Iraq

Haider Mahmod Jasim, Raad Habeeb Alasadi, Ahmed Yousef Lafta Hzaa, Mahmood Shakir Hashim